Mouse Hop PCR for Genotyping
200 bp genomic DNA fragment -- Wild Type
220 bp genomic DNA fragment -- Mutant
Working Conc. MM x 1 MM x ?? Final Conc
aTI H2O 10.90
10X PCR buffer 2.50 1X
25 mM MgCl2 1.00 2.5 mM
5 M Betaine 5.00 1 M
10 mM dNTPs 0.50 0.2 mM
10 M HopPro-F 1.00 0.4 M
10 M HopExon1-R 1.00 0.4 M
10 M LacZ-R 1.00 0.4 M
5.0 U/l Taq 0.10 0.5 U
23.00 l
Supernatant +2.00 l
25.00 l
Assay: 2 l Supernatant from mouse tail, ear, or yolk sac lysis sol'n
+ve Control: 2 l of previously positive mouse
(i.e., DW16L02: CD1 WT; H1 Ht +/-)
-ve Control: 2 l of H2O
PCR CYCLING CONDITIONS (1 3/4 h, MJ Research Program "DW-Hop"):
Denaturing 94°C 2 min
PCR 94°C 45 sec
58°C 45 sec 30 cycles
72°C 30 sec
Extension 72°C 5 min
Soak 4°C ∞
PCR REAGENTS:
- 10 mM dNTPs [Roche Molecular Biochemicals (BMB), Cat# 1 581 295].
- 5 U/l Taq DNA polymerase with 10X PCR buffer (containing 15 mM MgCl2) [Roche Molecular Biochemicals (BMB), Cat# 1 435 094].
- 25 mM MgCl2 [Roche Molecular Biochemicals (BMB), Cat# 1 600 770].
- 5 M Betaine [Sigma, Cat# B-0300].
- 2 l Mouse tail, ear, or yolk sac lysis supernatant.
RUN PCR PRODUCTS on a 2% agarose gel with 0.25 g/ml of EtBr (150 ml with 20-well comb). Expected PCR products: WT gene = 200-bp, Mutant gene = 220-bp. Three possibilities for Pups: 1) WT +/+ = 200-bp, 2) Ht +/- = both bands, and 3) Homozygous KO -/- = 220-bp. Load entire PCR reaction.
Hop
Reference: Chen, F. et al. (2002). Hop is an unusual homeobox gene that modulates cardiac development. Cell 110, 713-723.
HopPro-F: GCAGCACTTGAGGCGCTTCCTCAGTATAC
HopExon1-R: CCTTGTTGAAGTTGTACTCCAGGAT
LacZ-R: CACGGCTTACGGCAATAATGCCTTT
» Top